Review




Structured Review

Valiant Co Ltd fastprep 24 5g lysis machine mp biomedicals
Fastprep 24 5g Lysis Machine Mp Biomedicals, supplied by Valiant Co Ltd, used in various techniques. Bioz Stars score: 99/100, based on 5398 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mp+biomedicals+machine/FastPrep-24+5G/bio_rxiv__64898__2025__12__07__690893-330-6-10
Average 99 stars, based on 5398 article reviews
fastprep 24 5g lysis machine mp biomedicals - by Bioz Stars, 2026-09
99/100 stars

Images

Related Articles

other:

Article Title: Targeting the Wnt/β-catenin pathway in primary ovarian cancer with the porcupine inhibitor WNT974.
Article Snippet: The samples were then agitated on a MP Biomedicals FastPrep machine for three cycles of 45 s at full speed.

Article Title: Composition and Associations of the Infant Gut Fungal Microbiota with Environmental Factors and Childhood Allergic Outcomes
Article Snippet: Briefly, approximately 250 mg of frozen stool was used for each extraction and samples were homogenized twice using an MP Biomedicals FastPrep machine at speed 5.5 for 60 s. DNA from was subjected to 300-bp paired-end sequencing on an Illumina MiSeq using the ITS3/ITS4 primer pair (ITS3, 5′- GCATCGATGAAGAACGCAGC -3′; ITS4, 5′- TCCTCCGCTTATTGATATGC -3′) and V3 chemistry.

Article Title: TBCRC 019: An open label, randomized, phase II trial of nanoparticle albumin-bound paclitaxel (nab-PAC or Abraxane®) with or without the anti-death receptor 5 (DR5) monoclonal antibody tigatuzumab in patients with metastatic triple negative breast cancer
Article Snippet: The conical tubes containing tissue, ceramic beads and buffer were agitated in a MP Biomedicals FastPrep machine at 6.5 meters per second for 90 seconds to homogenize the tissue.

Article Title: Recurrent read-through fusion transcripts in breast cancer
Article Snippet: The conical tubes containing tissue, ceramic beads and buffer were then shaken in a MP Biomedicals FastPrep machine until the tissue was visibly homogenized (90 s at 6.5 meters per second).



Similar Products

99
Valiant Co Ltd fastprep 24 5g lysis machine mp biomedicals
Fastprep 24 5g Lysis Machine Mp Biomedicals, supplied by Valiant Co Ltd, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mp+biomedicals+machine/FastPrep-24+5G/bio_rxiv__64898__2025__12__07__690893-330-6-10
Average 99 stars, based on 1 article reviews
fastprep 24 5g lysis machine mp biomedicals - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

99
Valiant Co Ltd mp biomedicals fastprep 24tm machine
Mp Biomedicals Fastprep 24tm Machine, supplied by Valiant Co Ltd, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mp+biomedicals+machine/FastPrep-24+Classic/pmc12587422-49-30-30
Average 99 stars, based on 1 article reviews
mp biomedicals fastprep 24tm machine - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

99
Valiant Co Ltd mp biomedicals fastprep 24 machine
Mp Biomedicals Fastprep 24 Machine, supplied by Valiant Co Ltd, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mp+biomedicals+machine/FastPrep-24+Classic/pm40484974-62-14-14
Average 99 stars, based on 1 article reviews
mp biomedicals fastprep 24 machine - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

Image Search Results